Skip navigation
Please use this identifier to cite or link to this item: https://repositorio.unb.br/handle/10482/25598
Files in This Item:
File SizeFormat 
35n10a12.pdf201,33 kBAdobe PDFView/Open
Title: Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting
Teste de paternidade em eqüinos Mangalarga-Marchador pela técnica do DNA-"fingerprinting"
Authors: ANUNCIAÇÃO, CARLOS EDUARDO
ASTOLFI-FILHO, SPARTACO
Assunto:: breeding methods
molecular cloning
progeny testing
horses
identification
genetic polymorphism
métodos de melhoramento
clonagem molecular
teste de progênie
cavalos
identificação
polimorfismo
genético
Issue Date: 2000
Publisher: Embrapa Informação TecnológicaPesquisa Agropecuária Brasileira
Citation: Pesq. agropec. bras.,v.35,n.10,p.2007-2015,2000
Abstract: GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
Sondas moleculares de minissatélites CG-ricas isoladas do genoma humano têm apresentado pouca habilidade de individualização em cavalos. Neste trabalho foram isoladas novas seqüências de DNA, que podem ser utilizadas para teste de paternidade em cavalos. DNA genômico de cavalos Mangalarga-Marchador foi tratado com enzimas de restrição que digerem preferencialmente seqüências não-repetitivas, preservando, assim, a estrutura onde os mini e microssatélites estão localizados. Quatro clones (S01, S05, S07 and S09), selecionados a partir de uma livraria genômica com o oligonucleotídeo (TG)n, demonstraram um perfil de hibridização semelhante com bandas do tipo DNA "fingerprinting". Utilizando estas sondas, o poder de individualização obtido foi de 10-8, 10(5) vezes mais elevado do que o obtido com a M13, outra sonda do tipo GC-rica. Todos os clones foram eficientes para a determinação do parentesco em cruzamentos e apresentaram uma seqüência-consensus de 27 pb, GTTTCATTTATTATTCTTTGGAAGAAA, que estava repetida 12, 18, 11 e 21 vezes nos clones S01, S05, S07 e S09, respectivamente.
DOI: https://dx.doi.org/10.1590/S0100-204X2000001000012
Appears in Collections:Uso interno - em processamento

Show full item record Recommend this item " class="statisticsLink btn btn-primary" href="/handle/10482/25598/statistics">



Items in DSpace are protected by copyright, with all rights reserved, unless otherwise indicated.